DNA Better Spin Test
sketchfab
Here's a human-generated PDB file containing the complete sequence of a DNA molecule. > 1dna pdb human dna single-stranded sequence: 5'ggctagccttaggccgaccgtcgcacggccggcacgccggcacgccaggca 3'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 5'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 3'gcgcggcacgccggcacgccaggca structure: helix 1: 1-10 (5'ggctagccttagg') strand 2: 11-20 (ccgaccgtcgcac) strand 3: 21-30 (ggccggcacgccg) strand 4: 31-40 (gccaggca) modeling: use human dna secondary structure prediction software to predict the three-dimensional structure of this sequence.
With this file you will be able to print DNA Better Spin Test with your 3D printer. Click on the button and save the file on your computer to work, edit or customize your design. You can also find more 3D designs for printers on DNA Better Spin Test.