DNA, B-form, double-stranded, 50 base pairs

DNA, B-form, double-stranded, 50 base pairs

grabcad

DNA-B-form atomic structure, surface;Generated in pymol, mesh-simplified in meshlab to reduce file size;DNA sequence: TGCTAAGGATCTGGCTGCATGCTATGTTGATACACCTACACTGCTCGAAG(randomy generated using https://faculty.ucr.edu/~mmaduro/random.htm)PDB file generator: http://www.scfbio-iitd.res.in/software/drugdesign/bdna.jsp#I've printed these with Makerobot.I also uploaded two separate strands as two separate files; it might be possible to print them separately in a rubbery material and wind them up together (head-to-tail, of course, b.c. DNA is antiparallel'). However, I haven't attempted this yet.

Download Model from grabcad

With this file you will be able to print DNA, B-form, double-stranded, 50 base pairs with your 3D printer. Click on the button and save the file on your computer to work, edit or customize your design. You can also find more 3D designs for printers on DNA, B-form, double-stranded, 50 base pairs.