better devils 3d models

The world's most famous bust is getting a makeover, and it's not just a matter of cosmetic surgery. Scientists are working tirelessly to bring the 3,300-year-old queen back to life. The project, dubbed "Nefertiti in 3D," aims to recreate the face of...

Paddles boasting a sleek, zero-thickness design.

Customized version of https://www.thingiverse.com/thing:74322 Created with Customizer! ...https://www.thingiverse.com/apps/customizer/run?thing_id=74322

I really like elmuchacho's Mini Kossel frame brace (http://www.thingiverse.com/thing:626279) and B0rax's glass holder (http://www.thingiverse.com/thing:538746). Unfortunately, however, they don't quite work together. As a result, I've created this...

This text describes an object that was scanned using the MakerBot Digitizer, a cutting-edge desktop 3D scanning device. ...The process captures the shape and details of the item in 3D, allowing it to be replicated or manipulated digitally.

Here's a human-generated PDB file containing the complete sequence of a DNA molecule. ... > 1dna pdb human dna single-stranded sequence: 5'ggctagccttaggccgaccgtcgcacggccggcacgccggcacgccaggca 3'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc...

Here is the text rewritten in a more polished and professional tone: Eugene Pentland's design, a coin sorter, showcases an impressive collection of coins. ...Check out the original model here:...

French Horn to use for what ever you desire. ...This is a free file and should remain free no resale is allowed.

Help and Know-How at the Ultimaker Forum Post: https://ultimaker.com/en/community/22649-automatic-top-layer-sanding WARNING - The starting and ending G-code is used on my machines, but it will 100% crush the hotend with the bedclips if you use it...

I drew inspiration from the Pik1973 tool holder on Thingiverse, specifically design number 2445729. Using Tinkercad as my starting point, I re-created the design from scratch, making improvements to the holes and dimensions. As a result, we now have...

Fits most of cheap hubs

A specially designed TAG box for Infinity S7 models is marked with a unique identification that sets it apart from other variants.

Customized version of https://www.thingiverse.com/thing:4740308 Created with Customizer! ...https://www.thingiverse.com/apps/customizer/run?thing_id=4740308

The original thumb crank from SSD had some issues, including rough edges and poor grip. To address these problems, I designed a new version using OpenSCAD software. The result is an improved crank that fits M8 Z-rods, self-threads, and offers a...

Phone stand with a set of features that i couldn't find in other designs:has stiffening ribs so it doesn't wobble when you touch the screenbracket has a gap to insert a phone with a cable without taking it outbracket doesn't obstruct android...

Customized version of https://www.thingiverse.com/thing:4740308 Created with Customizer! ...https://www.thingiverse.com/apps/customizer/run?thing_id=4740308

Email me if you need help designing stuff. ...Enjoy https://www.facebook.com/buddyFB/

This object was made in Tinkercad. ...Edit it online https://www.tinkercad.com/things/dqwR8vykZTr

Customized version of https://www.thingiverse.com/thing:4775412 Created with Customizer! ...https://www.thingiverse.com/apps/customizer/run?thing_id=4775412

This is a remix of "Greedie, The Treasure Chest Mimic" by decay3d. I was unsatisfied with the hinges on the original, as two prints had their hinges break almost the moment I handed them to my niece and nephew.I used a 52% scaled-down version of...

Customized version of https://www.thingiverse.com/thing:3045130 Created with Customizer! ...https://www.thingiverse.com/apps/customizer/run?thing_id=3045130

Customized version of https://www.thingiverse.com/thing:4740308 Created with Customizer! ...https://www.thingiverse.com/apps/customizer/run?thing_id=4740308

I made the Housings a bit easier to print and flat from the inside. ... I use my own printed Springs so i needed the inside flat.

just an other wound counter. inner digit turns a bit harder, use as 10-digit. ...outer wheel moves smooth, use as 1-digit

This is an upgraded rendition that closely resembles its predecessor in appearance and essence.

Alamo Keychain correction

Cathal Garvey recently posted a challenge on Thingiverse list, "Mouse get!", which involves designing and printing a humane mouse trap using a Makerbot. He wants a trap that can hold a mouse securely. Cathal has designed his own trap and is currently...