DNA Keychain 3d models

A DNA model where the letters representing the bases of DNA contribute to the pairing. This is a continuation of my attempts to create something to help me remember which bases are which via 3D representations. ... Category: Interactive Art

A tweaked mirror replica of the Hello18 model is utilized to ensure that the DNA strand is printed with a standard right-twisted spiral structure - much like conventional double-stranded DNA, but not in the manner of zDNA.

Bottle opener with a DNA molecule wrapped around it. ...The DNA molecule is offset to one side so that it can be printed without support. Category: Kitchen & Dining

Medium sized desktop DNA sculpture that is 4" diameter x 6.5" tall. ...This is an update of my poorly done 2015 SketchUp model: https://3dwarehouse.sketchup.com/model/u724d5c6e-22ab-405a-b067-e375a49997b4/DNA-SculptureModel units are inch.

I envisioned creating a ring that resembles DNA, a molecular structure that forms the foundation of all life on Earth.

Scientists use puzzle pieces to construct an intricate replica of the DNA's iconic double helix structure.

A 3d model of a DNA-string. ...Modeled in 3ds max 2010, rendered with V-ray 1.5.

Model of DNA bases, used to demonstrate hydrogen bonding by the use of magnets (8x6x4mm cube). Category: Biology

I envisioned crafting an eye-catching ring that bears a striking resemblance to the iconic double helix structure of DNA.

DNA Base Model with Magnet Demonstrations, showcasing Hydrogen Bonding through Magnetic Attraction within an 8x6x4 Millimeter Cube.

The human DNA helix stands at an impressive 120 millimeters tall and 70 millimeters wide in diameter.

A precise replica of the twisted DNA molecule, simplified for hassle-free printing without the need for supporting structures.

A nice sculpture of DNA Strings, and a nice challenge to print right. ...Enjoy!Show your makes please!

Students Explore Dynamic Genetics by Interacting with this Realistic DNA Model Perfect for Classroom Experiments and Learning about Genomics.

... instructions vital to living organisms' development and functionality. Consisting of genes and other functional segments, DNA serves as a blueprint containing essential information for constructing cell components like proteins and RNA molecules.

Bring to Life the Fascinating World of Genomics with Animated 3D DNA Models Unlock the Secrets of the Genetic Code with Interactive Visualizations Witness the Intricacies of DNA Unfold Before Your Eyes The Cutting-Edge Technology Behind Animated 3D...

**NGSS DNA/RNA Manipulative Lesson Plan** This comprehensive lesson plan is designed for middle school to high school students and covers the composition and construction of DNA and RNA, including replication, transcription, and protein synthesis. 2....

DNA serves as a molecule that delivers genetic instructions crucial for the growth, development, functioning and reproduction of every living organism and many viruses known today. DNA and RNA are nucleic acids; together with proteins, lipids and...

The DNA molecule encodes the genetic instructions used by all known living organisms and many viruses to develop and function. Its unique structure makes it well-suited for storing biological information, which is replicated as its two strands are...

> 1dna pdb human dna single-stranded sequence: 5'ggctagccttaggccgaccgtcgcacggccggcacgccggcacgccaggca 3'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 5'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 3'gcgcggcacgccggcacgccaggca structure:...

DNA Strand Model This is a highly detailed DNA strand model created within cinema 4d. Two files are included: DNA STRANDS.C4D and DNA STRANDS.OBJ. There are four distinct models in the C4D file: 1. Short Coloured 2. Short Chrome 3. Long Coloured...

Molecular surface representation of a nanopore (PDB ID 6si7) together with the bacteriophage phi29 DNA polymerase (PDB ID 1xhz) and a piece of DNA. The nanopore and polymerase are sliced in half and have locations for magnets, while the DNA is...

my doctor client asked for something created for being a surprise for his student, So I design a pencil holder as the shape of DNA

A DNA clamp, also referred to as a sliding clamp, enhances processivity in DNA replication by encircling double-stranded DNA and serving as a mobile tether for numerous partner proteins like replicative DNA polymerases. In E. coli, it is composed of...

Beautiful bridges! ...DNA with magic filament. Try to print perfect bridges! There are four files. ...Two different heights (210mm, 146mm) and two different shapes of the bottom.

A DNA box for a luxury sedan measuring approximately 5 inches long by 1.6 inches wide and 1.2 inches tall is being designed.

this files is a mark page of DNA. ...It's perfect for students that to learn the biology and do no forgot pages importants!

DNA double helix.May better work with supports on the two strands (included in the gcode). 

DNA Strand Double Helix models done in solidworks, illustrative purposes only, not scientifically accurate. ...Two different models made using different methods, one shows the nucleotides

Discover wallpaper featuring the genetic makeup of renowned Marvel comic characters. ...Explore designs including the DNA of Iceman, Hulk, Spiderman, and Ironman.